logo mamin-navigator.ru MAMIN-NAVIGATOR.RU | Личный кабинет | Наши Контакты | Доставка товара

Hamid Mollah Risk Management Applications in Pharmaceutical and Biopharmaceutical Manufacturing


Sets forth tested and proven risk management practices in drug manufacturing Risk management is essential for safe and efficient pharmaceutical and biopharmaceutical manufacturing, control, and distribution. With this book as their guide, readers involved in all facets of drug manufacturing have a single, expertly written, and organized resource to guide them through all facets of risk management and analysis. It sets forth a solid foundation in risk management concepts and then explains how these concepts are applied to drug manufacturing. Risk Management Applications in Pharmaceutical and Biopharmaceutical Manufacturing features contributions from leading international experts in risk management and drug manufacturing. These contributions reflect the latest research, practices, and industry standards as well as the authors firsthand experience. Readers can turn to the book for: Basic foundation of risk management principles, practices, and applications Tested and proven tools and methods for managing risk in pharmaceutical and biopharmaceutical product manufacturing processes Recent FDA guidelines, EU regulations, and international standards governing the application of risk management to drug manufacturing Case studies and detailed examples demonstrating the use and results of applying risk management principles to drug product manufacturing Bibliography and extensive references leading to the literature and helpful resources in the field With its unique focus on the application of risk management to biopharmaceutical and pharmaceutical manufacturing, this book is an essential resource for pharmaceutical and process engineers as well as safety and compliance professionals involved in drug manufacturing.

10231.81 РУБ

похожие

Подробнее

Panos Kouvelis Handbook of Integrated Risk Management in Global Supply Chains


A comprehensive, one-stop reference for cutting-edge research in integrated risk management, modern applications, and best practices In the field of business, the ever-growing dependency on global supply chains has created new challenges that traditional risk management must be equipped to handle. Handbook of Integrated Risk Management in Global Supply Chains uses a multi-disciplinary approach to present an effective way to manage complex, diverse, and interconnected global supply chain risks. Contributions from leading academics and researchers provide an action-based framework that captures real issues, implementation challenges, and concepts emerging from industry studies.The handbook is divided into five parts: Foundations and Overview introduces risk management and discusses the impact of supply chain disruptions on corporate performance Integrated Risk Management: Operations and Finance Interface explores the joint use of operational and financial hedging of commodity price uncertainties Supply Chain Finance discusses financing alternatives and the role of financial services in procurement contracts; inventory management and capital structure; and bank financing of inventories Operational Risk Management Strategies outlines supply risks and challenges in decentralized supply chains, such as competition and misalignment of incentives between buyers and suppliers Industrial Applications presents examples and case studies that showcase the discussed methodologies Each topics presentation includes an introduction, key theories, formulas, and applications. Discussions conclude with a summary of the main concepts, a real-world example, and professional insights into common challenges and best practices. Handbook of Integrated Risk Management in Global Supply Chains is an essential reference for academics and practitioners in the areas of supply chain management, global logistics, management science, and industrial engineering who gather, analyze, and draw results from data. The handbook is also a suitable supplement for operations research, risk management, and financial engineering courses at the upper-undergraduate and graduate levels.

12920.14 РУБ

похожие

Подробнее

James Lam Implementing Enterprise Risk Management. From Methods to Applications


A practical, real-world guide for implementing enterprise risk management (ERM) programs into your organization Enterprise risk management (ERM) is a complex yet critical issue that all companies must deal with in the twenty-first century. Failure to properly manage risk continues to plague corporations around the world. ERM empowers risk professionals to balance risks with rewards and balance people with processes. But to master the numerous aspects of enterprise risk management, you must integrate it into the culture and operations of the business. No one knows this better than risk management expert James Lam, and now, with Implementing Enterprise Risk Management: From Methods to Applications, he distills more than thirty years worth of experience in the field to give risk professionals a clear understanding of how to implement an enterprise risk management program for every business. Offers valuable insights on solving real-world business problems using ERM Effectively addresses how to develop specific ERM tools Contains a significant number of case studies to help with practical implementation of an ERM program While Enterprise Risk Management: From Incentives to Controls, Second Edition focuses on the «what» of ERM, Implementing Enterprise Risk Management: From Methods to Applications will help you focus on the «how.» Together, these two resources can help you meet the enterprise-wide risk management challenge head on—and succeed.

5968.66 РУБ

похожие

Подробнее

Kenett Ron S. Operational Risk Management. A Practical Approach to Intelligent Data Analysis


Models and methods for operational risks assessment and mitigation are gaining importance in financial institutions, healthcare organizations, industry, businesses and organisations in general. This book introduces modern Operational Risk Management and describes how various data sources of different types, both numeric and semantic sources such as text can be integrated and analyzed. The book also demonstrates how Operational Risk Management is synergetic to other risk management activities such as Financial Risk Management and Safety Management. Operational Risk Management: a practical approach to intelligent data analysis provides practical and tested methodologies for combining structured and unstructured, semantic-based data, and numeric data, in Operational Risk Management (OpR) data analysis. Key Features: The book is presented in four parts: 1) Introduction to OpR Management, 2) Data for OpR Management, 3) OpR Analytics and 4) OpR Applications and its Integration with other Disciplines. Explores integration of semantic, unstructured textual data, in Operational Risk Management. Provides novel techniques for combining qualitative and quantitative information to assess risks and design mitigation strategies. Presents a comprehensive treatment of «near-misses» data and incidents in Operational Risk Management. Looks at case studies in the financial and industrial sector. Discusses application of ontology engineering to model knowledge used in Operational Risk Management. Many real life examples are presented, mostly based on the MUSING project co-funded by the EU FP6 Information Society Technology Programme. It provides a unique multidisciplinary perspective on the important and evolving topic of Operational Risk Management. The book will be useful to operational risk practitioners, risk managers in banks, hospitals and industry looking for modern approaches to risk management that combine an analysis of structured and unstructured data. The book will also benefit academics interested in research in this field, looking for techniques developed in response to real world problems.

9574.99 РУБ

похожие

Подробнее

Ngai Chan Hang Handbook of Financial Risk Management. Simulations and Case Studies


An authoritative handbook on risk management techniques and simulations as applied to financial engineering topics, theories, and statistical methodologies The Handbook of Financial Risk Management: Simulations and Case Studies illustrates the prac­tical implementation of simulation techniques in the banking and financial industries through the use of real-world applications. Striking a balance between theory and practice, the Handbook of Financial Risk Management: Simulations and Case Studies demonstrates how simulation algorithms can be used to solve practical problems and showcases how accuracy and efficiency in implementing various simulation methods are indispensable tools in risk management. The book provides the reader with an intuitive understanding of financial risk management and deepens insight into those financial products that cannot be priced traditionally. The Handbook of Financial Risk Management also features: Examples in each chapter derived from consulting projects, current research, and course instruction Topics such as volatility, fixed-income derivatives, LIBOR Market Models, and risk measures Over twenty-four recognized simulation models Commentary, data sets, and computer subroutines available on a chapter-by-chapter basis As a complete reference for practitioners, the book is useful in the fields of finance, business, applied statistics, econometrics, and engineering. The Handbook of Financial Risk Management is also an excellent text or supplement for graduate and MBA-level students in courses on financial risk management and simulation.

11945.85 РУБ

похожие

Подробнее

Wei Chen Financial Risk Management. Applications in Market, Credit, Asset and Liability Management Firmwide


A global banking risk management guide geared toward the practitioner Financial Risk Management presents an in-depth look at banking risk on a global scale, including comprehensive examination of the U.S. Comprehensive Capital Analysis and Review, and the European Banking Authority stress tests. Written by the leaders of global banking risk products and management at SAS, this book provides the most up-to-date information and expert insight into real risk management. The discussion begins with an overview of methods for computing and managing a variety of risk, then moves into a review of the economic foundation of modern risk management and the growing importance of model risk management. Market risk, portfolio credit risk, counterparty credit risk, liquidity risk, profitability analysis, stress testing, and others are dissected and examined, arming you with the strategies you need to construct a robust risk management system. The book takes readers through a journey from basic market risk analysis to major recent advances in all financial risk disciplines seen in the banking industry. The quantitative methodologies are developed with ample business case discussions and examples illustrating how they are used in practice. Chapters devoted to firmwide risk and stress testing cross reference the different methodologies developed for the specific risk areas and explain how they work together at firmwide level. Since risk regulations have driven a lot of the recent practices, the book also relates to the current global regulations in the financial risk areas. Risk management is one of the fastest growing segments of the banking industry, fueled by banks fundamental intermediary role in the global economy and the industrys profit-driven increase in risk-seeking behavior. This book is the product of the authors experience in developing and implementing risk analytics in banks around the globe, giving you a comprehensive, quantitative-oriented risk management guide specifically for the practitioner. Compute and manage market, credit, asset, and liability risk Perform macroeconomic stress testing and act on the results Get up to date on regulatory practices and model risk management Examine the structure and construction of financial risk systems Delve into funds transfer pricing, profitability analysis, and more Quantitative capability is increasing with lightning speed, both methodologically and technologically. Risk professionals must keep pace with the changes, and exploit every tool at their disposal. Financial Risk Management is the practitioners guide to anticipating, mitigating, and preventing risk in the modern banking industry.

5968.66 РУБ

похожие

Подробнее

Francois Longin Extreme Events in Finance. A Handbook of Value Theory and its Applications


A guide to the growing importance of extreme value risk theory, methods, and applications in the financial sector Presenting a uniquely accessible guide, Extreme Events in Finance: A Handbook of Extreme Value Theory and Its Applications features a combination of the theory, methods, and applications of extreme value theory (EVT) in finance and a practical understanding of market behavior including both ordinary and extraordinary conditions. Beginning with a fascinating history of EVTs and financial modeling, the handbook introduces the historical implications that resulted in the applications and then clearly examines the fundamental results of EVT in finance. After dealing with these theoretical results, the handbook focuses on the EVT methods critical for data analysis. Finally, the handbook features the practical applications and techniques and how these can be implemented in financial markets. Extreme Events in Finance: A Handbook of Extreme Value Theory and Its Applications includes: • Over 40 contributions from international experts in the areas of finance, statistics, economics, business, insurance, and risk management • Topical discussions on univariate and multivariate case extremes as well as regulation in financial markets • Extensive references in order to provide readers with resources for further study • Discussions on using R packages to compute the value of risk and related quantities The book is a valuable reference for practitioners in financial markets such as financial institutions, investment funds, and corporate treasuries, financial engineers, quantitative analysts, regulators, risk managers, large-scale consultancy groups, and insurers. Extreme Events in Finance: A Handbook of Extreme Value Theory and Its Applications is also a useful textbook for postgraduate courses on the methodology of EVTs in finance. François Longin, PhD, is Professor in the Department of Finance at ESSEC Business School, France. He has been working on the applications of extreme value theory to financial markets for many years, and his research has been applied by financial institutions in the risk management area including market, credit, and operational risks. His research works can be found in scientific journals such as The Journal of Finance. Dr. Longin is currently a financial consultant with expertise covering risk management for financial institutions and portfolio management for asset management firms.

11202.55 РУБ

похожие

Подробнее

Paolo Brandimarte Handbook in Monte Carlo Simulation. Applications Financial Engineering, Risk Management, and Economics


An accessible treatment of Monte Carlo methods, techniques, and applications in the field of finance and economics Providing readers with an in-depth and comprehensive guide, the Handbook in Monte Carlo Simulation: Applications in Financial Engineering, Risk Management, and Economics presents a timely account of the applicationsof Monte Carlo methods in financial engineering and economics. Written by an international leading expert in thefield, the handbook illustrates the challenges confronting present-day financial practitioners and provides various applicationsof Monte Carlo techniques to answer these issues. The book is organized into five parts: introduction andmotivation; input analysis, modeling, and estimation; random variate and sample path generation; output analysisand variance reduction; and applications ranging from option pricing and risk management to optimization. The Handbook in Monte Carlo Simulation features: An introductory section for basic material on stochastic modeling and estimation aimed at readers who may need a summary or review of the essentials Carefully crafted examples in order to spot potential pitfalls and drawbacks of each approach An accessible treatment of advanced topics such as low-discrepancy sequences, stochastic optimization, dynamic programming, risk measures, and Markov chain Monte Carlo methods Numerous pieces of R code used to illustrate fundamental ideas in concrete terms and encourage experimentation The Handbook in Monte Carlo Simulation: Applications in Financial Engineering, Risk Management, and Economics is a complete reference for practitioners in the fields of finance, business, applied statistics, econometrics, and engineering, as well as a supplement for MBA and graduate-level courses on Monte Carlo methods and simulation.

11686.01 РУБ

похожие

Подробнее

Matt Sekerke Bayesian Risk Management. A Guide to Model and Sequential Learning in Financial Markets


A risk measurement and management framework that takes model risk seriously Most financial risk models assume the future will look like the past, but effective risk management depends on identifying fundamental changes in the marketplace as they occur. Bayesian Risk Management details a more flexible approach to risk management, and provides tools to measure financial risk in a dynamic market environment. This book opens discussion about uncertainty in model parameters, model specifications, and model-driven forecasts in a way that standard statistical risk measurement does not. And unlike current machine learning-based methods, the framework presented here allows you to measure risk in a fully-Bayesian setting without losing the structure afforded by parametric risk and asset-pricing models. Recognize the assumptions embodied in classical statistics Quantify model risk along multiple dimensions without backtesting Model time series without assuming stationarity Estimate state-space time series models online with simulation methods Uncover uncertainty in workhorse risk and asset-pricing models Embed Bayesian thinking about risk within a complex organization Ignoring uncertainty in risk modeling creates an illusion of mastery and fosters erroneous decision-making. Firms who ignore the many dimensions of model risk measure too little risk, and end up taking on too much. Bayesian Risk Management provides a roadmap to better risk management through more circumspect measurement, with comprehensive treatment of model uncertainty.

5968.66 РУБ

похожие

Подробнее

Scenario Logic and Probabilistic Management of Risk in Business Engineering (Applied Optimization)


Book DescriptionIn this volume the methodological aspects of the scenario logic and probabilistic (LP) non-success risk management are considered. The theoretical bases of scenario non-success risk LP-management in business and engineering are also stated. Methods and algorithms for the scenario risk LP-management in problems of classification, investment and effectiveness are described. Risk LP- models and results of numerical investigations for credit risks, risk of frauds, security portfolio risk, risk of quality, accuracy, and risk in multi-stage systems reliability are given. In addition, a rather large number of new problems of estimation, analysis and management of risk are considered. Software for risk problems based on LP-methods, LP-theory, andGIE is described too.

10221 РУБ

похожие

Подробнее

Pavel Shevchenko V. Advances in Heavy Tailed Risk Modeling. A Handbook of Operational


A cutting-edge guide for the theories, applications, and statistical methodologies essential to heavy tailed risk modeling Focusing on the quantitative aspects of heavy tailed loss processes in operational risk and relevant insurance analytics, Advances in Heavy Tailed Risk Modeling: A Handbook of Operational Risk presents comprehensive coverage of the latest research on the theories and applications in risk measurement and modeling techniques. Featuring a unique balance of mathematical and statistical perspectives, the handbook begins by introducing the motivation for heavy tailed risk processes in high consequence low frequency loss modeling. With a companion, Fundamental Aspects of Operational Risk and Insurance Analytics: A Handbook of Operational Risk, the book provides a complete framework for all aspects of operational risk management and includes: Clear coverage on advanced topics such as splice loss models, extreme value theory, heavy tailed closed form loss distributional approach models, flexible heavy tailed risk models, risk measures, and higher order asymptotic approximations of risk measures for capital estimation An exploration of the characterization and estimation of risk and insurance modelling, which includes sub-exponential models, alpha-stable models, and tempered alpha stable models An extended discussion of the core concepts of risk measurement and capital estimation as well as the details on numerical approaches to evaluation of heavy tailed loss process model capital estimates Numerous detailed examples of real-world methods and practices of operational risk modeling used by both financial and non-financial institutions Advances in Heavy Tailed Risk Modeling: A Handbook of Operational Risk is an excellent reference for risk management practitioners, quantitative analysts, financial engineers, and risk managers. The book is also a useful handbook for graduate-level courses on heavy tailed processes, advanced risk management, and actuarial science.

11950.1 РУБ

похожие

Подробнее

Terje Aven Misconceptions of Risk


We all face risks in a variety of ways, as individuals, businesses and societies. The discipline of risk assessment and risk management is growing rapidly and there is an enormous drive for the implementation of risk assessment methods and risk management in organizations. There are great expectations that these tools provide suitable frameworks for obtaining high levels of performance and balance different concerns such as safety and costs. The analysis and management of risk are not straightforward. There are many challenges. The risk discipline is young and there area a number of ideas, perspectives and conceptions of risk out there. For example many analysts and researchers consider it appropriate to base their risk management policies on the use of expected values, which basically means that potential losses are multiplied with their associated consequences. However, the rationale for such a policy is questionable. A number of such common conceptions of risk are examined in the book, related to the risk concept, risk assessments, uncertainty analyses, risk perception, the precautionary principle, risk management and decision making under uncertainty. The Author discusses these concepts, their strenghts and weaknesses, and concludes that they are often better judged as misconceptions of risk than conceptions of risk. Key Features: Discusses common conceptions of risk with supporting examples. Provides recommendations and guidance to risk analysis and risk management. Relevant for all types of applications, including engineering and business. Presents the Author’s overall conclusions on the issues addressed throughout the book. All those working with risk-related problems need to understand the fundamental ideas and concepts of risk. Professionals in the field of risk, as well as researchers and graduate sutdents will benefit from this book. Policy makers and business people will also find this book of interest.

6710.03 РУБ

похожие

Подробнее

Terje Aven Misconceptions of Risk


We all face risks in a variety of ways, as individuals, businesses and societies. The discipline of risk assessment and risk management is growing rapidly and there is an enormous drive for the implementation of risk assessment methods and risk management in organizations. There are great expectations that these tools provide suitable frameworks for obtaining high levels of performance and balance different concerns such as safety and costs. The analysis and management of risk are not straightforward. There are many challenges. The risk discipline is young and there area a number of ideas, perspectives and conceptions of risk out there. For example many analysts and researchers consider it appropriate to base their risk management policies on the use of expected values, which basically means that potential losses are multiplied with their associated consequences. However, the rationale for such a policy is questionable. A number of such common conceptions of risk are examined in the book, related to the risk concept, risk assessments, uncertainty analyses, risk perception, the precautionary principle, risk management and decision making under uncertainty. The Author discusses these concepts, their strenghts and weaknesses, and concludes that they are often better judged as misconceptions of risk than conceptions of risk. Key Features: Discusses common conceptions of risk with supporting examples. Provides recommendations and guidance to risk analysis and risk management. Relevant for all types of applications, including engineering and business. Presents the Author’s overall conclusions on the issues addressed throughout the book. All those working with risk-related problems need to understand the fundamental ideas and concepts of risk. Professionals in the field of risk, as well as researchers and graduate sutdents will benefit from this book. Policy makers and business people will also find this book of interest.

6646.42 РУБ

похожие

Подробнее

Otilia M. Y. Koo Pharmaceutical Excipients. Properties, Functionality, and Applications in Research Industry


This book provides an overview of excipients, their functionalities in pharmaceutical dosage forms, regulation, and selection for pharmaceutical products formulation. It includes development, characterization methodology, applications, and up-to-date advances through the perspectives of excipients developers, users, and regulatory experts. Covers the sources, characterization, and harmonization of excipients: essential information for optimal excipients selection in pharmaceutical development Describes the physico-chemical properties and biological effects of excipients Discusses chemical classes, safety and toxicity, and formulation Addresses recent efforts in the standardization and harmonization of excipients

13069.65 РУБ

похожие

Подробнее

Andrew Sage P. Risk Modeling, Assessment, and Management


Presents systems-based theory, methodology, and applications in risk modeling, assessment, and management This book examines risk analysis, focusing on quantifying risk and constructing probabilities for real-world decision-making, including engineering, design, technology, institutions, organizations, and policy. The author presents fundamental concepts (hierarchical holographic modeling; state space; decision analysis; multi-objective trade-off analysis) as well as advanced material (extreme events and the partitioned multi-objective risk method; multi-objective decision trees; multi-objective risk impact analysis method; guiding principles in risk analysis); avoids higher mathematics whenever possible; and reinforces the material with examples and case studies. The book will be used in systems engineering, enterprise risk management, engineering management, industrial engineering, civil engineering, and operations research. The fourth edition of Risk Modeling, Assessment, and Management features: Expanded chapters on systems-based guiding principles for risk modeling, planning, assessment, management, and communication; modeling interdependent and interconnected complex systems of systems with phantom system models; and hierarchical holographic modeling An expanded appendix including a Bayesian analysis for the prediction of chemical carcinogenicity, and the Farmer’s Dilemma formulated and solved using a deterministic linear model Updated case studies including a new case study on sequential Pareto-optimal decisions for emergent complex systems of systems A new companion website with over 200 solved exercises that feature risk analysis theories, methodologies, and application Risk Modeling, Assessment, and Management, Fourth Edition, is written for both undergraduate and graduate students in systems engineering and systems management courses. The text also serves as a resource for academic, industry, and government professionals in the fields of homeland and cyber security, healthcare, physical infrastructure systems, engineering, business, and more.

12323.52 РУБ

похожие

Подробнее

Louis Anthony Cox, Jr. Breakthroughs in Decision Science and Risk Analysis


Discover recent powerful advances in the theory, methods, and applications of decision and risk analysis Focusing on modern advances and innovations in the field of decision analysis (DA), Breakthroughs in Decision Science and Risk Analysis presents theories and methods for making, improving, and learning from significant practical decisions. The book explains these new methods and important applications in an accessible and stimulating style for readers from multiple backgrounds, including psychology, economics, statistics, engineering, risk analysis, operations research, and management science. Highlighting topics not conventionally found in DA textbooks, the book illustrates genuine advances in practical decision science, including developments and trends that depart from, or break with, the standard axiomatic DA paradigm in fundamental and useful ways. The book features methods for coping with realistic decision-making challenges such as online adaptive learning algorithms, innovations in robust decision-making, and the use of a variety of models to explain available data and recommend actions. In addition, the book illustrates how these techniques can be applied to dramatically improve risk management decisions. Breakthroughs in Decision Science and Risk Analysis also includes: An emphasis on new approaches rather than only classical and traditional ideas Discussions of how decision and risk analysis can be applied to improve high-stakes policy and management decisions Coverage of the potential value and realism of decision science within applications in financial, health, safety, environmental, business, engineering, and security risk management Innovative methods for deciding what actions to take when decision problems are not completely known or described or when useful probabilities cannot be specified Recent breakthroughs in the psychology and brain science of risky decisions, mathematical foundations and techniques, and integration with learning and pattern recognition methods from computational intelligence Breakthroughs in Decision Science and Risk Analysis is an ideal reference for researchers, consultants, and practitioners in the fields of decision science, operations research, business, management science, engineering, statistics, and mathematics. The book is also an appropriate guide for managers, analysts, and decision and policy makers in the areas of finance, health and safety, environment, business, engineering, and security risk management.

9709.59 РУБ

похожие

Подробнее

Hamid mollah risk management applications in pharmaceutical and. Collection moll 12715010000 lenihlopokshop.ru

Смеситель для ванны Keuco Moll (52720010100). 45150 RUR. Keuco Moll ... в магазине Дюшес (8-495-211-73-77) ... Модель: Collection Moll 12715010000.

Стул Груп - импортер и производитель мебели на...

В интернет-магазине Стул Груп вы сможете купить мебель на металлокаркасе по самым низким ценам в Москве. Доставка по России, широкий ассортимент и высокое качество стульев и столов для вашего дома и офиса.

Полка Keuco Collection Moll 12759010000 со стеклоочистителем ...

Полка Keuco Collection Moll 12759010000 со стеклоочистителем, белая купить по лучшей цене в интернет-магазине. Технические характеристики и ...

Коллекция Keuco Moll купить, по недорогой цене в магазине ...

Коллекция бренда Keuco Moll, недорого купить в интернет-магазине. Огромный выбор ... Смеситель для ванны Keuco Moll 52720010100 хром. 36 191.

Return of Private Foundation

For calendar year 2013, or tax year beginning 01-01-2013. , and ending 12-31-2013 ... 52,720. 2,636. 0. 50,084. W c Other professional fees (attach schedule) . . . . 19. 175,657 ...... NEWYORK,NY 10036. BROADWAY MALL ASSOCIATION.

Prop Class Parcel # Land Building Total PRV Total Tax Payer Tax ...

01-01-203-015 $212,760. $936,400 ...... 03-26-105-004. $52,720. $414,360. $467,080. $0. PVIP ELMHURST II LLC. 3062 ...... PNORTHLAND MALL LTD. 5030.

Download the hORFeome V8.1 list - BCCM

638, ORF81007-G08, pENTR223-KIAA0101, 81007, G08, KIAA0101, KIAA0101 ...... keratin associated protein 4-1, 52720, 384, BC103846.2, LT733502, 85285 ...... pENTR223-MALL, 81012, F02, MALL, mal, T-cell differentiation protein-like ...

Global top 25 deals 2017

3, Time period : on and after 01/01/2009 and up to and including 31/12/2017 .... Global shopping centre manager, Sopping mall investment trust services ...... 59, Post and telecommunications, 13,730, 36,143, 222,435, 21,286, 73,871, 52,720 ...

Детский стул от Kettler | Каталог

Кресло BERRI FREE. Артикул: 6726-0ХХ. 51.899,00 руб. 39.990,00 руб. 51.899,00 руб. 39.990,00 руб. 49.499,00 руб. 35.990,00 руб. Кресло Berri Free X. Артикул: W20102-ХХХХ. Стул Chair. Артикул: 6725-ХХХ. Стул Chair. Артикул: 6725-ххх. 35.990,00 руб.

Купить детскую мебель Moll в интернет-магазине...

Детская мебель от производителя Moll купить в интернет-магазине Kinder-Aktiv в Москве. Заказ на сайте и по тел. +7 (495) 974-33-80. ... Существует такое крылатое выражение: «все начинается со школьной скамьи». Удобная, современная и комфортная парта обеспечивает ребенку благоприятную атмосферу на уроках, правильную посадку, а также возможность хорошо усваивать информацию.

Приставка MOLL Joker - Side Top - Мир Парт

Рейтинг: 4 - 1 отзыв<br />Приставка MOLL Joker - Side Top по цене . Наш телефон в Москве: + 7 (495) 151-00-60.

Что нельзя фотографировать в ОАЭ - правила и запреты в ...

+38 (044) 500-01-01. Все агентства Сети Агентств Горящих Путевок, где можно купить путевку:http://www.hottour.com.ua/where_to_buyКружка с бамбуковой ручкой EcoWoo Для папы подставкой ...www.ausra.ru/krujka-s-bambukovoj-ruchkoj-ecowoo-dlya-papi-podstavkoj.htmlСохраненная копияСмеситель для ванны Keuco Moll 52720 0101, Burberry Body Gold, Acca Kappa Крем для лица против морщин увлажняющий 1869 50 мл, Принт картридж ...

SLV Уличный светильник C Pol 231475 купить в Симферополе

Gernetic Иммуномодулирующая крем маска Immuno 150 мл, Porada Журнальный столик Woodstock, Смеситель для ванны Keuco Moll 52720 0101, ...

DVTestLib/Data/USA_Housing.csv (rajacode) - Microsoft Azure ...

... Nicholas Mall Apt. 058 East Danielle, OR 53708" 70805.61068360135 ...... Mill Ashleychester, IN 02878-0101" 82816.56093860955,5.087438796538176 ...... AA 52720" 72583.25333779282,6.5218210373448136,5.773618813540487 ...

Keuco Collection Moll коллекция | Аксессуары, Смесители

Рейтинг: 5 - 1 голос<br />Современная коллекция Keuco Collection Moll наглядно демонстрирует тот факт, что сегодня не ... Коллекция: Collection Moll ... Артикул: K52720010100.

Купить стулья в Москве от проверенных постановщиков...

Чтобы купить кухонные стулья в Москве, можно вообще никуда не ехать, а сделать заказ прямо из дома или с работы. В продаже потребитель найдет у нас буквально любой вариант стульев, которые идеально подходят под оформление Вашего помещения. Это могут быть...

Приставки и дополнения moll Joker Екатеринбург

Купить дополнительные элементы Moll Joker! Доставка по России!

Latest data - Centre for Sustainable Energy

105, 0740-0818-7660-1621-1002, 0101-2817-6620-7600-4803, 9/23/2008, 18-20, .... 10/28/2010, 21-22 The Mall, LONDON, Greater London Authority, W5 2PJ ...... Ventilation, 1,318, 370, 81, 142, 40, 0, 0, 487,660, 106,758, 187,156, 52,720.

Детская мебель Детские столы Moll

Модель "Детские столы Moll". Регулируемые по высоте детские столы Moll. Ваш малыш больше не будет сутулиться из-за слишком низкого стола или высокого стула! Преимущества: Подвижность в сидячем положении, что особенно важно с точки зрения ортопедии. Плавное изменение угла наклона столешницы парты Moll. Комбинации столов с возможностями дополнительного оборудования и расширения. Приятный подбор цвета и декора.

Детские стул moll - регулируемые стулья (трансформер)

Официальный сайт партнера moll в Южном федеральном округе. Для жителей Волгограда. +7 (8442) 33-16-26. +7 (902) 3-125-135. Для остальных регионов. +7 (902) 3-125-135. Каталог. ... Купите качественные регулируемые стулья moll для правильной осанки вашего ребенка. © DERROSSI, 2014. 400131, г. Волгоград, ул. Коммунистическая, 10 Телефон: +7 (8442) 33-16-26 +7 (8442) 33-16-39 +7 (961) 697-00-44 moll-yug@mail.ru.

the macerich company - corporate-ir.net

2 мая 2018 г. - Mall portfolio occupancy was 94.0% at March 31, 2018 compared to 94.3% at March 31, 2017 ...... Tenant and other receivables, net, (17,942, ), 52,720 ...... Tysons Corner Center (50%), 01/01/24, 4.13, %, 388,448, —, 388,448.

Download book PDF - Springer Link

DOI 10.1007/978-3-642-52720-3. ALLE RECHTE, ...... 0,367 0,586 0,250 0,620 0,101 0,702 0,0678 0,744. 2. 0,418 0,570 0,299 ...... (215) ein, So erhält mall.

Стул-кресло - 2 499 руб., в Москве на аналоге Юла

Стул-кресло. В наличии 2 шт. Состояние идеальное, практически новые - в использовании были всего 1 месяц. Современная дышащая обивка. Цвет... ... Стул-кресло. В наличии 2 шт. Состояние идеальное, практически новые - в использовании были всего 1 месяц.

Отзывы о Стул для письменного стола Ikea "Мольте"

Покупали этот стул для первоклассницы. Понравился дизайн и невысокая цена. Изначально рассчитывали, что стул будет временным, на 1-2 года, поэтому выбрали такой бюджетный вариант. Стул довольно симпатичный, ребенку понравился. Собирается легко, как конструктор. Довольно увесистый...

Canadian Crime Statistics 1994 - Government of Canada Publications

the local Statistics Canada offices, or by mall order to Statistics Canada, Operations and ...... 52,720. 37,927. 18,006. 40,569. 20,660. 19,187. 21,104. 24,707. 27,268 ...... 01 01. ^ 3. <. OT OT. OT OT. < < ra « ra c. <. D . c 01 V. ^ eo. 73 U 01 0).

Приставка moll joker side top poseidon-shop.ru

Боковая полка Side Top для Moll Joker применяется для расширения рабочей зоны парты сбоку;Полка может быть установлена на различной высоте ...

Столы и стулья :: Стулья для школьника :: Стул Pondi

Стул Pondi Главное свойство этого стула – его эргономичное устройство. Высоту спинки, высоту стула, а так же глубину сидения в нем можно настроить в зависимости от роста пользователя, что обеспечивает правильное положение тела ребенка во время занятий.Удо.

Полка Keuco Collection Moll со стеклоочистителем, антрацит ...

Keuco Collection Moll со стеклоочистителем, белая, 8 840 р. белый / хром, глянцевая / матовая, hi- ... Другие товары из коллекции Keuco Collection Moll ...

Collection moll 12715010000 lenihlopokshop.ru

Смеситель для ванны Keuco Moll (52720010100). 45150 RUR. Keuco Moll ... в магазине Дюшес (8-495-211-73-77) ... Модель: Collection Moll 12715010000.

Смесители для душа Keuco, смесители для душа: фото, заказ на ...

Смеситель термостатический Keuco Edition 11 51130 010500. Производитель: Keuco. Отложить. Смеситель для ванны Keuco Moll 52720 010100.Не найдено: 0101Смесители для ванны Keuco металлические, смесители для ...www.abitant.com › Каталог › Сантехника › Сантехника для ваннойСохраненная копияОтложить. Смеситель термостатический Keuco Moll 52773 010181. Производитель: ... Смеситель для ванны Keuco Moll 52720 010100. Производитель: ...Не найдено: 010152720(その他|業務用厨房用品) - 楽天市場https://search.rakuten.co.jp › ... › 業務用厨房用品Сохраненная копияПеревести эту страницу楽天市場-「52720」(その他<業務用厨房用品<業務用厨房機器・用品<キッチン用品・食器・ ... [BFA0101] クイジプロ スリーインワン ファンネル 74−7152 65506071527.

Conselleria de Justícia, Administració Pública, Reformes ... - DOGV

13 июл. 2018 г. - escala auxiliar de gestión, C2-01-01, sector administración general para el personal de la Administración de la Generalitat, disponen que trans ...

Купить аксессуары для ванной Keuco Collection Moll по ...

Аксессуары для ванной Keuco Collection Moll по выгодным ценам в интернет -магазине. ... KEUCO Collection Moll Угловая корзинка для душа, белая.

KEUCO, Collection Moll Корзинка для душа, белая — Главная ...

KEUCO, Collection Moll Корзинка для душа, белая. Производитель: KEUCO. Артикул: 12758 010000. Цвeт отделки: хром. Тип монтажа: подвесные.

near Ike - IP Mall

14 февр. 2018 г. - 52720, 52730 and 50451, I am advised that the drawings were made after each ... With respect to the enclosed JFD drawings 11881-0101 and.

Стулья Moll Maximo, Scooter, S6 здесь / moll.com.ru

Детский стул Moll. У немецкой компании детские стулья представлены двумя моделями: Maximo 15 и Scooter 15 . Оба стула имеют сменные чехлы для сиденья и спинки, сиденье может быть отрегулировано по высоте и глубине, спинка в свою очередь регулируется по высоте. Две модели детских стульев Moll могут вращаться, но только Maximo 15 имеет блокировку вращения.

Traffic Volume Report New York State Department cof Transportation

25 июл. 2011 г. - 0101. 0579. 0581. 0580. 0581. 0582. 0131. 0583. 0584. 0585. 0016. 0586. YR. County. Order ...... 52720. 51800. 56520. 46600. 65050. 50800. 51960. 38610. 3770. 3410. 5330. 4920 ...... MALL BLVD. JAMESTOWN WEST ...

o. o . o. o - FoundationSearch

Number and street (or PObox number If mall IS not delivered to street address). I Room/sUite B Telephone number ...... P 01/01/16 12/31/16. P 01/01/15 12/31/16.

Приставка-расширение Side Top Joker - Moll

Приставка-расширение moll Side Top Joker - это увеличение столешницы письменного стола moll Joker на 40 см! С каждым учебным годом количество ...

Sheet1 - mBio

28 июл. 2015 г. - 824, s15409, GGAGAGUUCUGGACAGCCUtt, 7851, NM_005434, MALL ...... 2371, s52720, GGAUCUAACUUGAUAUUCAtt, 390181, NM_001005323 ...... GCGUAAACCCUAUCUCUAAtt, 9768, NM_001029989, KIAA0101 ...

Детский компьютерный стул Moll Woody M

Ретро парикмахерские парикмахерское кресло массажист верстак барный стул косметический табурет поднимаясь вращающихся стул вращающийся. 0.0 (0 голоса(ов)) Магазин: MG-purple Store.

Здесь найдется все!

Экспериментальная система поиска. Программно-аппаратный комплекс с веб-интерфейсом ...

Стул-кресло для школьника фирмы moll - Москва...

продам стул ученический MOLL MAXIMO, регулируется по высоте сиденье и спинка, а также сиденье по глубине посадки. Шкала регулировки находится на ножке самого стула. Б/у, но в хорошем состоянии, качественный неубиваемый стул. Продаю потому, что мой ребенок вырос. Есть еще такой же стул ( сине-зел.обивка), тоже в хорошем состоянии.Каждый продаю за 30% от стоимости нового. Цена: 7000.00 руб. Тел.: 8 (903) 666-0041.

Official PDF , 506 pages - World Bank Documents

2011. 2021. 71-81 81-91 91-01 01-11 11-21. Kathmandu MC ...... 13,52,720. 527,620. 504,500. 320,600. 31,000. 6,500. 7500. 17,000. 71,500. 21,500. 50,000 ...... and houses in the city can further be defined as Mall as, the Shahs and the ...

Полка Keuco Collection Moll со стеклоочистителем, белая купить ...

Интернет-магазин Гидромаркет предлагает купить товар Полка Keuco Collection Moll со стеклоочистителем, белая по цене 10120 руб. ☆ Бесплатная ...

Приставка moll Joker - Side Top – Официальный сайт moll в ...

Боковая навесная полка Side Top для письменного стола moll может монтироваться на различной высоте как с левой, так и с правой стороны стола.

Moll wbzx0saf9r9z.ru

Дополнительный элемент Moll Приставка moll Joker - Side Top. Боковая .... Две модели детских стульев Moll могут вращаться, но только Maximo 15 имеет блокировку вращения. ..... Смеситель для ванны Keuco Moll ( 52720010100).

Вращающиеся кресла и стулья - купить...

Кресло руководителя, кресло оператора, кресло детское, стулья, компьютерный cтол с ДОСТАВКОЙ в Mstul.ru (МЕГАСТУЛ)! ... Кресло Бюрократ VIKING-8 черная с красным экокожа 6'520 руб. Кресло Бюрократ MC-201-H синяя сетка, сиденье черное подголовник 6'730 руб. Кресло Бюрократ MC-201-H салатовая сетка, сиденье черное подголо 6'730 руб. Кресло Бюрократ CH-808AXSN ткань TW черная вставки экокожа 4'270 руб. Кресло Бюрократ CH-204NX ткань синий морская тематика 2'425 руб.

Стулья Eames-ds style (9 видов): каталог, низкие цены...

Офисные. Табуреты. Стул Knot. Normann Copenhagen. Цена: 38300 руб. Стул Elementaree. Hay. Цена: 11200 руб. Стул Pavilion AV 4. &Tradition. Цена: от 33200 руб. Стул Soft Edge 12 Upholstery. Hay. Цена: от 37500 руб. Стул Fiber Bar Tube. Muuto. Цена: от 23600 руб. Стул Icha. Massproductions. Цена: от 41600 руб. Стул Beetle Wood. Gubi. Цена: от 70200 руб. Стул Result. Hay. Цена: 22500 руб. Стул Primo. Mattiazzi. Цена: от 22900 руб. Барный стул Soft Edge 30. Hay. Цена: 16100 руб.

Смесители черного цвета дешево - купить Смесители в Москве ...

Nova MTE35 Noveo Z0101_R Noveo Z0102_R Noveo Z0103_R Noveo Z0106_R Novita 102102447. Novita 102108925. Novita 104101130. Novita 104102447

Прайс

PJAR003, PARTS-MALL, Амортизатор задний газовый Sonata VI (NF 2005 - 2010), 1950, 2 ...... 52720-24000, Hyundai/KiA, ПОДШИПНИК ЗАДНЕЙ СТУПИЦЫ ELANTRA (до 95г.)/ ...... FA0101, BM, ФИЛЬТР ВОЗДУШНЫЙ Creta, 380, 1, 0.

Растущий стул Pondi – купить в Воронеже и Липецке...

Детская мебель Moll является использованной но тщательно отборной, ухоженной, и в очень хорошем состоянии ! Для каждого набора можно отдельно подобрать ортопедический стул. - Почему мебель должна расти вместе с ребенком? Чтобы быть здоровым и правильно учиться, ребенок не должен подстраиваться под мебель - пусть мебель подстроится под него. Дети растут. И мебель moll «растет» вместе с ними, учитывая актуальный рост ребенка.

Spring, 2005 - The Society for Siberian Irises

EK-01-01. SIB (dip.), 38" (97 cm), M. S. wine red; style arms lighter with blue midrib; ... KONCERT F MOLL (Lech Lomarnicki, R. 2004). ...... Atalissa, IA 52720.

Официальный сайт Эрготроника; Интернет магазин удобной и ...

Эргономичность и комфорт кресел. Мы стараемся найти удобный стул или кресло. Мы просто ...

Price - KA174.Ru

PJB141A, PARTS-MALL, Амортизатор задний левый газ Спектра Ижевск/ Шума 2, 2520, 1 ...... 52720-24000, Hyundai/KiA, ПОДШИПНИК ЗАДНЕЙ СТУПИЦЫ ELANTRA (до 95г.)/ ...... FA0101, BM, ФИЛЬТР ВОЗДУШНЫЙ Creta, 490, 2.

Полка Keuco Collection Moll 12757 белая купить по низкой цене в ...

Полка Keuco Collection Moll 12757 белая в интернет-магазине Сантехника. Характеристики, фото, описание. Покупайте с установкой и без! Доставка ...

Стул Компьютерное кресло Nadir черное, цена 6300...

Если вы решили купить компьютерный стул или кресло - просто добавьте товар в корзину и оформите заказ. ... Купить. Компьютерное кресло Бюрократ T-9908AXSN. В наличии. Код: 244597.0. 15440 ₽. Купить. Компьютерное кресло Бюрократ MC-815-Н светло-серый/черный. В наличии. Код: 308523.0. 15786 ₽. Купить. Компьютерное кресло Бюрократ MC-815-Н черный/темно-серый. В наличии. Код: 308525.0. 15786 ₽. Купить. Компьютерное кресло Бюрократ MC-815-Н черный. В наличии. Код: 351508.0.

Стулья: Купить в Москве - цены в магазинах на Aport.ru

Новинка от Moll - стул с уникальными возможностями! Глубина и высота сиденья, высота спинк. 44 063руб. + отзыв о магазине. В магазин Купить в "MyMoll.Ru". ... Кресло для геймера Aerocool AC220 AIR-BG , черно-з Кресло для геймера Aerocool AC220 AIR-BG , черно-зеленое, с перфорацией, до 150 кг, размер, см (ШхГхВ) : 66х63х125/133. Aerocool 4713105968415. 17 200руб. + отзыв о магазине. В магазин Купить в "ОЛДИ".

The Newfoundland and Labrador Gazette - Service NL

17 мар. 2006 г. - HCK Holdings Limited. 2005-11-08 52720 ...... 2006-01-01 38623 MACLEOD SAWING & DRILLING LTD. 2006-01-03 11560 ...... Millbrook Mall.

Стул Moll Maximo купить, заказать стул Moll Maximo: цена в

Купить стулья Moll Maximo в интернет-магазине The Furnish с доставкой по Москве и России! Заказать, всегда в наличии, акции, скидки и лучшие цены для вас! ... Вы можете выбрать и купить детские стулья moll maximo в интернет-магазине Furnish. В нашем каталоге стильной мебели – 17,714 товарных позиций от европейских и российских брендов, а цены от 340 до 828 990 рублей. Нужна доставка по Москве, Санкт-Петербургу или городам России?

Table S1

3211, 3276_81007@G08_4523_KIAA0101, 81007@G08, KIAA0101 ...... 4018, 4103_81009@E12_52720_KRTAP4-1, 81009@E12, KRTAP4-1 ...... 81012@F02, MALL, TATAACACGGAGGCAAATAGGACAAATGAA, BC003179.1, 462.

Moll 52720 0101 - serii-vse.ru

Подпятник "Fix-O-Moll" позволяет предохранить от повреждения покрытие пола. 218 RUR. Fix-o-moll ... Смеситель для ванны Keuco Moll (52720010100).

Парты-трансформеры, растущие парты для дома, регулируемые ...

Парты-трансформеры (растущие парты для дома), регулируемые (растущие) и ортопедические ...

АРМАТУРА ТРУБОПРОВОДНАЯ ДЛЯ АТОМНЫХ СТАНЦИЙ ...

... к крнтнчос-нм откати дла Л М0^>Ь1^ибю1аЮШС И^>СЖН>^ (в ь а 1чнк: Адрес Гс-1- фв (mall I'aipaP отчик InaciJBiiuiKl продукции: Адрес Тем. факс 87.

ADVISORSHARES TRUST Annual Report June 30, 2017 - 48

28 авг. 2017 г. - exposure to Retail loan names. The weakness in mall-based retailers has moved to the rest of retail as ...... 52,720. Household Products/Wares — 1.4%. ACCO Brands Corp.*. 1,223. 14,248 ...... Inc., 7.00%, 01/01/22‡. 155,000.

Итальянская, американская, немецкая, испанская мебель в ...

Интерьерный салон №1. Интерьеры в наличии, а так же Американская мебель в наличии, немецкая ...

Приставка Moll Side Top для Joker | Moll Киев, Украина

Навесная боковая приставка для письменного стола-парты moll Joker подарит свободное пространство и поможет поддерживать порядок на рабочем ...

Keuco Moll 52720010100 – купить смеситель, сравнение цен ...

Смеситель Keuco Moll 52720010100 ✓ Купить по лучшей цене ... Каталог Keuco 2019 - новинки, хиты продаж и самые актуальные модели Keuco.

Смеситель Keuco Collection Moll 52720010100 для ванны ...

Код товара: 00166268. Артикул: 52720010100. Производитель: Keuco. Серия : Collection Moll. Модель: Collection Moll 52720010100. Страна: Германия.

MOLL - Детская мебель из Германии, купить немецкие парты ...

Компания Стелс предлагает полный выбор мебели фабрики Moll для детей в нашем интернет ...

Мебельный центр Гранд, торговый центр, …

Как добраться до Мебельный центр Гранд: на машине: Мебельный Торговый Комплекс «ГРАНД» расположен на Ленинградском шоссе, с левой стороны, …

Растущий ортопедический стул Moll. Ребенок в восторге!

Хотите сохранить хорошую осанку ребёнку? Растущие ортопедические стулья Moll сделают это за Вас! Сделано в Германии. Гарантия до 10 лет. ... Четкие, точные и функциональные решения moll обеспечивают детям хорошо обустроенное место для работы, учебы и игры, которое в том числе учитывает их собственные предпочтения и вкусы. Доктор Дитер Брайтхекер Германия. Главная страница > Стулья. Ортопедические стулья Moll для школьника. Maximo. от 0 p.

Приставка Side Top (для Joker) - Детская мебель moll в Волгограде

Прямоугольная боковая приставка для детских письменных столов Joker позволит дополнительно расширить стол на 40 см. Крепить данную приставку ...

MOLL Кресло вращающееся Maximo Fresh 351611 - Москва

Кресло Стул Бюрократ KF-2 / Or-07 вращающийся коричневый Or-07 искусственная кожа 935084 ОГО! 3190 р. Купить. Кресло Стул Бюрократ KF-1 / INDIGO26-21 вращающийся синий 26-21 664159 ОГО! 2590 р. Купить. Кресло Стул Бюрократ KF-2 / Or-21 вращающийся бордовый Or-21 искусственная кожа 935091 ОГО! 3190 р. ... Keuco Collection Moll 12755 019000 хром Интернет Сантехника. 6167 р. В корзину. Keuco Collection Moll 12701 010600 хром Интернет Сантехника. 6767 р. В корзину.

Купить смеситель с изливом keuco moll 52720010100 за 35 259 ...

Предлагаем купить смеситель с изливом keuco moll 52720010100 в Москве по самым выгодным ценам. Гарантия от ... Модель, 52720010100. Материал ...

ART CKS 012111 - Notepad - City of Muscatine

1000.1521.52720. 407866 25207. P 248. 00017 ...... 1000.1313.65230. 407289 319 D42-0101. P 247 ..... 2,429.92 *VENDOR TOTAL. PC MALL GOV INC.

Annual Report 2001 - Zonebourse.com

which in turn held an interest in Europea Pall Mall Ltd. Owing to the nature of its business, ...... 30/01/01. Deutschemarks. Sabadell International Finance LTD. (1) (a) ...... 52,720. 378,213. 128,610. 301,941. 198,024. 9,934. 30,051. -. -. -. 15,025.

Смеситель для ванны однорычажный с изливом, хром Keuco ...

Смеситель для ванны однорычажный с изливом, хром Keuco COLLECTION MOLL 52720010100 – купить по самой выгодной цене. Отзывы, фото ...

Стулья и кресла

Купить детское крутящееся компьютерное кресло для дома в интернет-магазине, низкие цены на офисные кресла для компьютера для работы и учебы. Детские компьютерные кресла и стулья для письменного стола с быстрой доставкой по всей России!

Запчасть DAC42760039 - Купить подшипник ступицы во ... - Фарпост

SAT. Аналогичен DAC42760039. 01:01, сегодняАвтотрейд ... 00:36, сегодняInterАвто. Подшипник передней ступицы (50310-3E102, 51720-2J000, 52720-1F000) .... Подшипник ступицы передней! kia carnival Parts-Mall арт. PSB-H003 ...

Стул Eames DSW - низкая цена и быстрая доставка!

Глубина и высота сиденья, высота спинки регулируются без усилий (имеется шкала);Сиденье и спинка специальной формы, особо подходящей для детей;Чехлы легко снять и постирать, либо заменить на новые;Сиденье оборудовано амортизаторами для лучшей динамики при сидении и большего комфорта;Стойка стула оснащена удобной ручкой;Широкая пятилучевая крестовина обеспечивает стулу устойчивость и безопасность...

mobile equipment and wind energy solutions - MOLL-MOTOR

52720. 32400. 26320. 98. 55. 1500. 2500. 2100. 6G. 157. 64000. 56000. 52000. 52000. 32800. 26640. 70. 55 ...... SS 426 01 01. Svezia. Sweden. Schweden.

как выбрать стул video | Как выбрать компьютерное кресло

Коленный стул, стул балансир. Поговорим о эргономике и здоровье спины. Смотрите обзор моих эргономических,... Как выбрать компьютерное кресло и правильно сидеть за компьютером. ... Какой стул выбрать ? ▻ Скачайте книгу "Основы столярного мастерства": http://jurprime.ru/pages/sh_book ▻ Чтобы попасть...

Дополнительный Элемент Moll Приставка Moll Joker - Side Top ...

Боковая полка Side Top для Moll Joker применяется для расширения рабочей зоны парты сбоку;Полка может быть установлена на различной высоте ...

Приставка moll Joker - Side Top, Германия - уточнить условия ...

9 536,00 ₽ - В наличии<br />Популярная модель Приставка moll Joker - Side Top, изготовленная компанией Moll, производство Германия из качественного материала ЛДСП, ...

Запчасть 1224 - Купить в Барнауле! Цены. Фото автозапчастей

... IB4129, DAC3874003633, 713618020, 713618150, RL1216, RL1224, 330364, 38BWD15AJB01, DAC40700043, 9036938002, 9036938001, 52720M2010, .

Стул с подлокотниками 620

Стул с подлокотниками 620 купить недорого в интернет магазине офисной мебели. ... Стул с подлокотниками Материал: дерево, кожа, кожзам Цвет: темный орех/черешня, коричневая/темно-зеленая Вес: 21,3 Объем: 0,38 Размеры: 52,5х63,5х100 Примечание: Каркас и подлокотники – дерево темный орех/черешня, кожа-сплит коричневая/темно-зеленая, обивка – декоративные гвозди. Дизайн проект. Доставка в срок.

Стулья - купить дизайнерские стулья в интернет-магазине...

Детское кресло для компьютера и занятий. Что может быть важнее здоровья ребенка и его радостных глаз? ... Нередко, в качестве подарка родители желают купить именно кресло для ребенка, так как особенно ребенку необходимо сидеть на правильном кресле при игре на компьютере или за уроками. Мамы и папы стремятся подобрать все самое лучшее, качественное и безопасное, так же не малое внимание, уделяя красоте, индивидуальным особенностям и вкусам малыша.

Корзинка для душа Keuco Collection Moll белая за 6700р ...

Корзинка для душа ☆ Keuco Collection Moll белая ☆ - цена 6700р ➀ Официальный дилер Keuco ➁ Германия ➂ Характеристики ➃ Видео ➄ Отзывы ➅ ...

Концерты для духового оркестра

Партита.РФ Первая в российской сети библиотека нот для духового оркестра Сайт работает с 1 ноября 2005 года

Компьютерные столы и кресла - avito.ru

Объявления о продаже угловых компьютерных столов и офисных кресел раздела компьтерные ...

Полка Keuco Collection Moll со стеклоочистителем, белая купить ...

От 6 910,00 ₽ до 9 160,00 ₽ - В наличии<br />Полка Keuco Collection Moll со стеклоочистителем, белая купить по лучшей цене в нашем интернет магазине 9160р. заказ по телефону 8 495 665 70 ...

Детские компьютерные ортопедические кресла и стулья...

Купить надежное и удобное кресло компьютерное детское Вы сможете в нашем интернет-магазине «Компьютерные кресла» в Москве. Тел.: +7 (495) 727-77-82. К Вашему вниманию: бесплатная доставка в кротчайшие сроки, привлекательные цены, широкий ассортимент и высокое качество обслуживания.

Invoicing Deadline Spreadsheet. - Universal Service Administrative ...

... 2015, FRONTIER COMMUNICATIONS OF AMERICA, 143001110, 01/01/2018, 7/1/2018 ...... 1921, 25421, Cedar County Memorial Hospital Medical Mall Clinic ...... 3337, 52720, Baptist Surgical Associates - Carrolton, 17188061, 2017 ...

Полка Keuco Collection Moll со стеклоочистителем, белая 12759 ...

Доступные цены на Полка Keuco Collection Moll со стеклоочистителем, белая в интернет-магазине SantPrice.ru. Большой выбор, скидки. Вы можете ...

Смеситель для ванны Keuco Moll 52720 0101 купить в ...

На novokuibyshevsk.zolotoyuleyshop.ru Вы можете купить Смеситель для ванны Keuco Moll 52720 0101 по выгодной цене в Новокуйбышевске.

Keuco Moll 52720.0101 приобрести < Распродажа ~ 120x240.ru

Смеситель для ванны Moll 52720.010100 Keuco для наружного монтажа керамический картридж с автоматическим переключением ванна/душ

Купить мебель и спортивные комплексы для школьника в Москве

Предлагаем купить фирменную мебель для школьников и детские спортивные комплексы из ...

Детское кресло Moll Maximo Белый/Черный

Стулья и кресла. Детское кресло Moll Maximo Белый/Черный. Детское кресло Moll Maximo Белый/Черный. Товар дня. Успей купить. ... Регулируемые стулья для школьников Moll Maximo — продуманное решение для организации правильного рабочего места для ученика. При покупке подобной вещи следует обратить внимание на 2 аспекта: во-первых, стул должен быть безопасным с точки зрения эргономики, а во-вторых, он должен максимально соответствовать интерьеру детской комнаты.

EPIK (English Program In Korea)|Middle School |(Paper) THAT'LL BE ...

5 февр. 2010 г. - 작성자 : bsfPiods 작성일 : 2018-11-11 01:01 IP : 178.159.37.39 삭제 ...... the perfect shopping mall what would you include Why essay writing ...

Онанизм у мужчины и женщины

Л. Я. Якобзон ОНАНИЗМ У МУЖЧИНЫ И ЖЕНЩИНЫ Для врачей и студентов Второе издание

Кресла купить в Москве | All-Biz Ltd

Ширина кресла - 57,5, см; Глубина кресла - 55, см; Высота кресла - 80, см; Высота сиденья - 46, см; Материал каркаса - массив бука; Материал обивки - ткань; Производитель - Мебель Китая; Цвет - white / light grey; Мягкость сиденья - мягкое; Вес - 6,4, кг...

Регулируемый стул Moll Scooter | Moll Киев, Украина

Купить детскую мебель Moll в Украине. Регулируемый стул Moll Scooter | Moll Киев, Украина Киев. ☎ ‎+38 (050) 38 814 34‎ ☎ +38 (067) 53 738 53. ... moll — немецкое качество в каждой детали. Регулируемый стул Moll Scooter. Код товара: Н/Д. Доступность: На складе.

Простой Ресторанный Стул Пластиковый Стул...

Стул из столового гарнитура. Общее использование: Мебель для дома. ... Включающ Ретро стиль и простоту в структуре дизайна, этот набор кресло будет красиво приспособиться к любому d & eacute; cor. Особенности.

NGC 2029 - Astronomy-Mall.com

... some brighter stars including mag 9.0 HD 52720 appears detached to the NW. ...... MCG -01-01-007 is extremely to very faint, very small, slightly elongated ...

annual - Regina Apostolic Church

19 мар. 2017 г. - Income Statement from 01/01/2016 to 12/31/2016 ...... Christmas Kettle Campaign at the Southland Mall in December, as well as prepared meals for families ..... 52,720. 56,634. 63,000. Sundry (Board portion). 79,170. 64,513.

Joel Bessis Risk Management in Banking


The seminal guide to risk management, streamlined and updated Risk Management in Banking is a comprehensive reference for the risk management industry, covering all aspects of the field. Now in its fourth edition, this useful guide has been updated with the latest information on ALM, Basel 3, derivatives, liquidity analysis, market risk, structured products, credit risk, securitizations, and more. The new companion website features slides, worked examples, a solutions manual, and the new streamlined, modular approach allows readers to easily find the information they need. Coverage includes asset liability management, risk-based capital, value at risk, loan portfolio management, capital allocation, and other vital topics, concluding with an examination of the financial crisis through the utilisation of new views such as behavioural finance and nonlinearity of risk. Considered a seminal industry reference since the first editions release, Risk Management in Banking has been streamlined for easy navigation and updated to reflect the changes in the field, while remaining comprehensive and detailed in approach and coverage. Students and professionals alike will appreciate the extended scope and expert guidance as they: Find all «need-to-know» risk management topics in a single text Discover the latest research and the new practices Understand all aspects of risk management and banking management See the recent crises – and the lessons learned – from a new perspective Risk management is becoming increasingly vital to the banking industry even as it grows more complex. New developments and advancing technology continue to push the field forward, and professionals need to stay up-to-date with in-depth information on the latest practices. Risk Management in Banking provides a comprehensive reference to the most current state of the industry, with complete information and expert guidance.

4083.82 РУБ

похожие

Подробнее

Karen Horcher A. Essentials of Financial Risk Management


A concise introduction to financial risk management strategies, policies, and techniques This ideal guide for business professionals focuses on strategic and management issues associated with financial risk. Essentials of Financial Risk Management identifies risk-mitigation policies and strategies; suggestions for determining an organizations risk tolerance; and sources of risk associated with currency exchange rates, interest rates, credit exposure, commodity prices, and other related events. Examples illustrate risk scenarios and offer tips on an array of management alternatives, including changes in the way business is conducted and hedging strategies involving derivatives.

4523.62 РУБ

похожие

Подробнее

Global Association of Risk Professionals Foundations Energy Management. An Overview the Sector and Its Physical Financial Markets


GARPs Fundamentals of Energy Risk Management introduces investors to the basic components and some of the basic terminology used in the energy industry. It covers the commodity cycle, energy use and sources, and various risk types, various energy products and the markets where energy is traded. It also introduces certain risk management fundamentals and real option thinking. The book is GARPs required text used by risk professionals looking to obtain their Certificate in Energy Risk Management.

7162.39 РУБ

похожие

Подробнее

Frances Cowell Crisis Wasted?. Leading Risk Managers on Culture


Effective risk management in today’s ever-changing world Crisis Wasted? Leading Risk Managers on Risk Culture sheds light on today’s risk management landscape through a unique collection of interviews from risk leaders in both the banking and investment industries. These interviews zero in on the risk culture of organisations, effective risk management in practice, and the sometimes paradoxical effects of new regulations and how they affect decision-making in financial organisations They offer genuine insight into regulatory processes and priorities and their implications for the stability of the global financial system. As trending topics in the risk management field, each of these subject areas is relevant to the work of today’s risk management professionals. In addition to the forward-focused text, this reference provides access to a wealth of premium online content. Risk management has become an area of focus for companies since the financial crises that shook the international community over the past decade, but, despite high levels of introspection and changes to key processes, many financial houses are still experiencing large losses. Understanding today’s risk environment can help you improve risk management tactics. Access essential information both in print and online Discover the most important topics in today’s risk management field Explore interviews with 1 risk management leaders Learn about ground-breaking recent innovations in risk management thinking Crisis Wasted? Leading Risk Managers on Risk Culture is an integral resource for professionals responsible for minimising organisational risk, as well as those who want to better understand the risk culture of today’s world.

4083.82 РУБ

похожие

Подробнее

Отсутствует Risk Management. Foundations For a Changing Financial World


Key readings in risk management from CFA Institute, the preeminent organization representing financial analysts Risk management may have been the single most important topic in finance over the past two decades. To appreciate its complexity, one must understand the art as well as the science behind it. Risk Management: Foundations for a Changing Financial World provides investment professionals with a solid framework for understanding the theory, philosophy, and development of the practice of risk management by Outlining the evolution of risk management and how the discipline has adapted to address the future of managing risk Covering the full range of risk management issues, including firm, portfolio, and credit risk management Examining the various aspects of measuring risk and the practical aspects of managing risk Including key writings from leading risk management practitioners and academics, such as Andrew Lo, Robert Merton, John Bogle, and Richard Bookstaber For financial analysts, money managers, and others in the finance industry, this book offers an in-depth understanding of the critical topics and issues in risk management that are most important to today’s investment professionals.

6282.8 РУБ

похожие

Подробнее

John Fraser Enterprise Risk Management. Todays Leading Research and Best Practices for Tomorrows Executives


Essential insights on the various aspects of enterprise risk management If you want to understand enterprise risk management from some of the leading academics and practitioners of this exciting new methodology, Enterprise Risk Management is the book for you. Through in-depth insights into what practitioners of this evolving business practice are actually doing as well as anticipating what needs to be taught on the topic, John Fraser and Betty Simkins have sought out the leading experts in this field to clearly explain what enterprise risk management is and how you can teach, learn, and implement these leading practices within the context of your business activities. In this book, the authors take a broad view of ERM, or what is called a holistic approach to ERM. Enterprise Risk Management introduces you to the wide range of concepts and techniques for managing risk in a holistic way that correctly identifies risks and prioritizes the appropriate responses. This invaluable guide offers a broad overview of the different types of techniques: the role of the board, risk tolerances, risk profiles, risk workshops, and allocation of resources, while focusing on the principles that determine business success. This comprehensive resource also provides a thorough introduction to enterprise risk management as it relates to credit, market, and operational risk, as well as the evolving requirements of the rating agencies and their importance to the overall risk management in a corporate setting. Filled with helpful tables and charts, Enterprise Risk Management offers a wealth of knowledge on the drivers, the techniques, the benefits, as well as the pitfalls to avoid, in successfully implementing enterprise risk management. Discusses the history of risk management and more recently developed enterprise risk management practices and how you can prudently implement these techniques within the context of your underlying business activities Provides coverage of topics such as the role of the chief risk officer, the use of anonymous voting technology, and risk indicators and their role in risk management Explores the culture and practices of enterprise risk management without getting bogged down by the mathematics surrounding the more conventional approaches to financial risk management This informative guide will help you unlock the incredible potential of enterprise risk management, which has been described as a proxy for good management.

6282.8 РУБ

похожие

Подробнее

Joel Bessis Risk Management in Banking


Never before has risk management been so important. Now in its third edition, this seminal work by Joël Bessis has been comprehensively revised and updated to take into account the changing face of risk management. Fully restructured, featuring new material and discussions on new financial products, derivatives, Basel II, credit models based on time intensity models, implementing risk systems and intensity models of default, it also includes a section on Subprime that discusses the crisis mechanisms and makes numerous references throughout to the recent stressed financial conditions. The book postulates that risk management practices and techniques remain of major importance, if implemented in a sound economic way with proper governance. Risk Management in Banking, Third Edition considers all aspects of risk management emphasizing the need to understand conceptual and implementation issues of risk management and examining the latest techniques and practical issues, including: Asset-Liability Management Risk regulations and accounting standards Market risk models Credit risk models Dependencies modeling Credit portfolio models Capital Allocation Risk-adjusted performance Credit portfolio management Building on the considerable success of this classic work, the third edition is an indispensable text for MBA students, practitioners in banking and financial services, bank regulators and auditors alike.

5729.91 РУБ

похожие

Подробнее

Joel Bessis Risk Management in Banking


Never before has risk management been so important. Now in its third edition, this seminal work by Joël Bessis has been comprehensively revised and updated to take into account the changing face of risk management. Fully restructured, featuring new material and discussions on new financial products, derivatives, Basel II, credit models based on time intensity models, implementing risk systems and intensity models of default, it also includes a section on Subprime that discusses the crisis mechanisms and makes numerous references throughout to the recent stressed financial conditions. The book postulates that risk management practices and techniques remain of major importance, if implemented in a sound economic way with proper governance. Risk Management in Banking, Third Edition considers all aspects of risk management emphasizing the need to understand conceptual and implementation issues of risk management and examining the latest techniques and practical issues, including: Asset-Liability Management Risk regulations and accounting standards Market risk models Credit risk models Dependencies modeling Credit portfolio models Capital Allocation Risk-adjusted performance Credit portfolio management Building on the considerable success of this classic work, the third edition is an indispensable text for MBA students, practitioners in banking and financial services, bank regulators and auditors alike.

5675.68 РУБ

похожие

Подробнее

Dennis Douroumis Hot-Melt Extrusion. Pharmaceutical Applications


Hot-melt extrusion (HME) – melting a substance and forcing it through an orifice under controlled conditions to form a new material – is an emerging processing technology in the pharmaceutical industry for the preparation of various dosage forms and drug delivery systems, for example granules and sustained release tablets. Hot-Melt Extrusion: Pharmaceutical Applications covers the main instrumentation, operation principles and theoretical background of HME. It then focuses on HME drug delivery systems, dosage forms and clinical studies (including pharmacokinetics and bioavailability) of HME products. Finally, the book includes some recent and novel HME applications, scale -up considerations and regulatory issues. Topics covered include: principles and die design of single screw extrusion twin screw extrusion techniques and practices in the laboratory and on production scale HME developments for the pharmaceutical industry solubility parameters for prediction of drug/polymer miscibility in HME formulations the influence of plasticizers in HME applications of polymethacrylate polymers in HME HME of ethylcellulose, hypromellose, and polyethylene oxide bioadhesion properties of polymeric films produced by HME taste masking using HME clinical studies, bioavailability and pharmacokinetics of HME products injection moulding and HME processing for pharmaceutical materials laminar dispersive & distributive mixing with dissolution and applications to HME technological considerations related to scale-up of HME processes devices and implant systems by HME an FDA perspective on HME product and process understanding improved process understanding and control of an HME process with near-infrared spectroscopy Hot-Melt Extrusion: Pharmaceutical Applications is an essential multidisciplinary guide to the emerging pharmaceutical uses of this processing technology for researchers in academia and industry working in drug formulation and delivery, pharmaceutical engineering and processing, and polymers and materials science. This is the first book from our brand new series Advances in Pharmaceutical Technology. Find out more about the series here.

14475.57 РУБ

похожие

Подробнее

Marvin Arras Corporate Risk Management in Emerging Markets


Managing risks is essential for corporations and has a tremendous impact on their performance. However, doing it sufficiently can be challenging, especially in Emerging Markets (EMs). Due to its underdeveloped environment, corporations often face enormous difficulties while managing risk in these countries. The purpose of this study is to outline the issues and differences of corporate risk management in emerging economies compared to Developed Markets (DMs). After a short introduction, the second chapter describes risk management in DMs and gives an overview of common corporate risks. The third chapter characterizes EMs and details its risk management. In that connection, the focus lies on (1) the risk management process, (2) the measurement of risk and (3) the tools and techniques to mitigate risks in EMs. Conclusively, the study summarizes the main factors for corporations that are fundamental for managing risks in EMs effectively.

4214 РУБ

похожие

Подробнее

Pramod Kulkarni Aerosol Measurement. Principles, Techniques, and Applications


Aerosol Measurement: Principles, Techniques, and Applications Third Edition is the most detailed treatment available of the latest aerosol measurement methods. Drawing on the know-how of numerous expert contributors; it provides a solid grasp of measurement fundamentals and practices a wide variety of aerosol applications. This new edition is updated to address new and developing applications of aerosol measurement, including applications in environmental health, atmospheric science, climate change, air pollution, public health, nanotechnology, particle and powder technology, pharmaceutical research and development, clean room technology (integrated circuit manufacture), and nuclear waste management.

16725.89 РУБ

похожие

Подробнее

Ekins Sean Pharmaceutical Data Mining. Approaches and Applications for Drug Discovery


Leading experts illustrate how sophisticated computational data mining techniques can impact contemporary drug discovery and development In the era of post-genomic drug development, extracting and applying knowledge from chemical, biological, and clinical data is one of the greatest challenges facing the pharmaceutical industry. Pharmaceutical Data Mining brings together contributions from leading academic and industrial scientists, who address both the implementation of new data mining technologies and application issues in the industry. This accessible, comprehensive collection discusses important theoretical and practical aspects of pharmaceutical data mining, focusing on diverse approaches for drug discovery—including chemogenomics, toxicogenomics, and individual drug response prediction. The five main sections of this volume cover: A general overview of the discipline, from its foundations to contemporary industrial applications Chemoinformatics-based applications Bioinformatics-based applications Data mining methods in clinical development Data mining algorithms, technologies, and software tools, with emphasis on advanced algorithms and software that are currently used in the industry or represent promising approaches In one concentrated reference, Pharmaceutical Data Mining reveals the role and possibilities of these sophisticated techniques in contemporary drug discovery and development. It is ideal for graduate-level courses covering pharmaceutical science, computational chemistry, and bioinformatics. In addition, it provides insight to pharmaceutical scientists, principal investigators, principal scientists, research directors, and all scientists working in the field of drug discovery and development and associated industries.

12062.98 РУБ

похожие

Подробнее

Imam Wahyudi Risk Management for Islamic Banks. Recent Developments from Asia and the Middle East


Gain insight into the unique risk management challenges within the Islamic banking system Risk Management for Islamic Banks: Recent Developments from Asia and the Middle East analyzes risk management strategies in Islamic banking, presented from the perspectives of different banking institutions. Using comprehensive global case studies, the book details the risks involving various banking institutions in Indonesia, Malaysia, UAE, Bahrain, Pakistan, and Saudi Arabia, pointing out the different management strategies that arise as a result of Islamic banking practices. Readers gain insight into risk management as a comprehensive system, and a process of interlinked continuous cycles that integrate into every business activity within Islamic banks. The unique processes inherent in Islamic banking bring about complex risks not experienced by traditional banks. From Shariah compliance, to equity participation contracts, to complicated sale contracts, Islamic banks face unique market risks. Risk Management for Islamic Banks covers the creation of an appropriate risk management environment, as well as a stage-based implementation strategy that includes risk identification, measurement, mitigation, monitoring, controlling, and reporting. The book begins with a discussion of the philosophy of risk management, then delves deeper into the issue with topics like: Risk management as an integrated system The history, framework, and process of risk management in Islamic banking Financing, operational, investment, and market risk Shariah compliance and associated risk The book also discusses the future potential and challenges of Islamic banking, and outlines the risk management pathway. As an examination of the wisdom, knowledge, and ideal practice of Islamic banking, Risk Management for Islamic Banks contains valuable insights for those active in the Islamic market.

5277.55 РУБ

похожие

Подробнее

Terje Aven Uncertainty in Risk Assessment. The Representation and Treatment of Uncertainties by Probabilistic Non-Probabilistic Methods


Explores methods for the representation and treatment of uncertainty in risk assessment In providing guidance for practical decision-making situations concerning high-consequence technologies (e.g., nuclear, oil and gas, transport, etc.), the theories and methods studied in Uncertainty in Risk Assessment have wide-ranging applications from engineering and medicine to environmental impacts and natural disasters, security, and financial risk management. The main focus, however, is on engineering applications. While requiring some fundamental background in risk assessment, as well as a basic knowledge of probability theory and statistics, Uncertainty in Risk Assessment can be read profitably by a broad audience of professionals in the field, including researchers and graduate students on courses within risk analysis, statistics, engineering, and the physical sciences. Uncertainty in Risk Assessment: Illustrates the need for seeing beyond probability to represent uncertainties in risk assessment contexts. Provides simple explanations (supported by straightforward numerical examples) of the meaning of different types of probabilities, including interval probabilities, and the fundamentals of possibility theory and evidence theory. Offers guidance on when to use probability and when to use an alternative representation of uncertainty. Presents and discusses methods for the representation and characterization of uncertainty in risk assessment. Uses examples to clearly illustrate ideas and concepts.

7539.23 РУБ

похожие

Подробнее

Christopher Culp L. Risk Transfer. Derivatives in Theory and Practice


Based on an enormously popular «derivative instruments and applications» course taught by risk expert Christopher Culp at the University of Chicago, Risk Transfer will prepare both current practitioners and students alike for many of the issues and problems they will face in derivative markets. Filled with in-depth insight and practical advice, this book is an essential resource for those who want a comprehensive education and working knowledge of this major field in finance, as well as professionals studying to pass the GARP FRM exam. Christopher L. Culp, PhD (Chicago, IL), is a Principal at CP Risk Management LLC and is also Adjunct Professor of Finance at the University of Chicago. He is the author of Corporate Aftershock (0-471-43002-1) and The ART of Risk Management (0-471-12495-8).

7463.97 РУБ

похожие

Подробнее

Clifford Rossi A Risk Professionals Survival Guide. Applied Best Practices in Management


Balanced, practical risk management for post – financial crisis institutions Fundamentals of Risk Management fills a critical gap left by existing risk management texts. Instead of focusing only on quantitative risk analysis or only on institutional risk management, this book takes a comprehensive approach. The disasters of the recent financial crisis taught us that managing risk is both an art and a science, and it is critical for practitioners to understand how individual risks are integrated at the enterprise level. This book is the only resource of its kind to introduce all of the key risk management concepts in a cohesive case study spanning each chapter. A hypothetical bank drawn from elements of several real world institutions serves as a backdrop for topics from credit risk and operational risk to understanding big-picture risk exposure. You will be able to see exactly how each rigorous concept is applied in actual risk management contexts. Fundamentals of Risk Management includes: Supplemental Excel-based Visual Basic (VBA) modules, so you can interact directly with risk models Clear explanations of the importance of risk management in preventing financial disasters Real world examples and lessons learned from past crises Risk policies, infrastructure, and activities that balance limited quantitative models This book provides the element of hands-on application necessary to put enterprise risk management into effective practice. The very best risk managers rely on a balanced approach that leverages every aspect of financial operations for an integrative risk management strategy. With Fundamentals of Risk Management, you can identify and control risk at an expert level.

5968.66 РУБ

похожие

Подробнее

Douglas Hubbard W. The Failure of Risk Management. Why Its Broken and How to Fix It


An essential guide to the calibrated risk analysis approach The Failure of Risk Management takes a close look at misused and misapplied basic analysis methods and shows how some of the most popular «risk management» methods are no better than astrology! Using examples from the 2008 credit crisis, natural disasters, outsourcing to China, engineering disasters, and more, Hubbard reveals critical flaws in risk management methods–and shows how all of these problems can be fixed. The solutions involve combinations of scientifically proven and frequently used methods from nuclear power, exploratory oil, and other areas of business and government. Finally, Hubbard explains how new forms of collaboration across all industries and government can improve risk management in every field. Douglas W. Hubbard (Glen Ellyn, IL) is the inventor of Applied Information Economics (AIE) and the author of Wileys How to Measure Anything: Finding the Value of Intangibles in Business (978-0-470-11012-6), the #1 bestseller in business math on Amazon. He has applied innovative risk assessment and risk management methods in government and corporations since 1994. «Doug Hubbard, a recognized expert among experts in the field of risk management, covers the entire spectrum of risk management in this invaluable guide. There are specific value-added take aways in each chapter that are sure to enrich all readers including IT, business management, students, and academics alike» —Peter Julian, former chief-information officer of the New York Metro Transit Authority. President of Alliance Group consulting «In his trademark style, Doug asks the tough questions on risk management. A must-read not only for analysts, but also for the executive who is making critical business decisions.» —Jim Franklin, VP Enterprise Performance Management and General Manager, Crystal Ball Global Business Unit, Oracle Corporation.

3138.26 РУБ

похожие

Подробнее

Комментарии


#hamid mollah risk management applications in pharmaceutical and #ветровик rein для skoda fabia ii 2007 2010 хэтчбек на накладной скотч 3м 4 шт #лупа veber 7513 3x #постельное белье valtery кпб сатин печатный cl 283 евро #ролик petzl tandem cable #напольный вентилятор scarlett comfort sc sf111b12 белый #кабель usb nordost blue heaven 3 m #кпб сатин печатный cl 283 евро #селебрити биофарма лтд #front upper fairing cowling headlight headlamp stay bracket holder for 2007 2008 #постельное белье valtery кпб сатин печатный cl 244 евро #fabrikators #meb 114 black #круг шлифовальный луга абразив 1 500 х 25 305 25а 90 h i j 16м #электрический накопительный водонагреватель thermex giro 100 #frau hilda 9 180x190 #футболка тренировочная nike dry academy 18 893693 719 #подвесной светильник abaka bez wenge 13653 #кпб сатин печатный cl 244 евро #2т 125 300мм 510085 #vc3012m #чехол для удилищ yoshi onyx patch сase складной цвет желтый 135 см #смеситель для раковины d k bayern erlangen da1182101 #соковыжималка unit ucj 416 ce 0363908 белый голубой #постельное белье valtery кпб сатин печатный cl 282 евро #кпб сатин печатный cl 282 евро #cozy a45682exp #zhiyun zw b02 wireless thumb controller for crane crane m smooth 4 3 smooth q #replay lx75 7 5x17 6x139 7 d106 1 et25 s #водяной полотенцесушитель терминус классик 50х83 п7 #ibrahim dincer thermal management of electric vehicle battery systems #мексидол таблетки 125 мг n30 #набор бит matrix с магнитным держателем 61 шт #model 27 6 5x16 5x114 3 d60 1 et45 wb #матовая мастика для волос сильной фиксации 57гр

Подпишитесь на новые товары в mamin-navigator.ru